Ferredoxin from a Red Alga, Porphyra umbilicalis

نویسندگان
چکیده

برای دانلود باید عضویت طلایی داشته باشید

برای دانلود متن کامل این مقاله و بیش از 32 میلیون مقاله دیگر ابتدا ثبت نام کنید

اگر عضو سایت هستید لطفا وارد حساب کاربری خود شوید

منابع مشابه

Genome Analysis of Planctomycetes Inhabiting Blades of the Red Alga Porphyra umbilicalis

Porphyra is a macrophytic red alga of the Bangiales that is important ecologically and economically. We describe the genomes of three bacteria in the phylum Planctomycetes (designated P1, P2 and P3) that were isolated from blades of Porphyra umbilicalis (P.um.1). These three Operational Taxonomic Units (OTUs) belong to distinct genera; P2 belongs to the genus Rhodopirellula, while P1 and P3 rep...

متن کامل

Isolation and Characterization of PhotosystemIIComplex from Red Alga Porphyra haitanesis

Ying Xia Li, Guang Ce Wang*, Jian Feng Niu, Zheng Quan Gao & Chang Sheng Chen School of Life Science and Technology, Nanyang Normal University, Nanyang 473 061, China Key Laboratory of Experimental Marine Biology, Institute of Oceanology, Chinese Academy of Sciences, Nanhai Road 7, Qingdao 266 071, China. Nation Deep Sea Center of State Oceanic Administration, People’s Republic of China, Qingda...

متن کامل

Insights into the red algae and eukaryotic evolution from the genome of Porphyra umbilicalis (Bangiophyceae, Rhodophyta).

Porphyra umbilicalis (laver) belongs to an ancient group of red algae (Bangiophyceae), is harvested for human food, and thrives in the harsh conditions of the upper intertidal zone. Here we present the 87.7-Mbp haploid Porphyra genome (65.8% G + C content, 13,125 gene loci) and elucidate traits that inform our understanding of the biology of red algae as one of the few multicellular eukaryotic ...

متن کامل

Efficiency of ferredoxins and flavodoxins as mediators in systems for hydrogen evolution.

1. The efficiencies of ferredoxins and flavodoxins from a range of sources as mediators in systems for hydrogen evolution were assessed. 2. In supporting electron transfer from dithionite to hydrogenase of the bacterium Clostridium pasteurianum, highest activity was shown by the ferredoxin from the cyanobacterium Chlorogloeopsis fritschii and flavodoxin from the bacterium Megasphaera elsdenii. ...

متن کامل

The nucleotide sequence of 5S rRNA from a red alga, Porphyra yezoensis.

The nucleotide sequence of 5S rRNA from Porphyra yezoensis has been determined to be: pACGUACGGCCAUAUCCGAGACACGCGUACCGGAACCCAUUCCGAAUUCCGAAGUCAAGCGUCCGCGAGUUGGGUUAGU - AAUCUGGUGAAAGAUCACAGGCGAACCCCCAAUGCUGUACGUC. This 5S rRNA sequence is most similar to that of Euglena gracilis (63% homology).

متن کامل

ذخیره در منابع من


  با ذخیره ی این منبع در منابع من، دسترسی به آن را برای استفاده های بعدی آسان تر کنید

ژورنال

عنوان ژورنال: European Journal of Biochemistry

سال: 1976

ISSN: 0014-2956,1432-1033

DOI: 10.1111/j.1432-1033.1976.tb10879.x